Search on : Sequences


 Add this item to the list  ITS296



Show reverse-complement sequence

Basics statistics(Total length: 557)
Sequence ChartSequence Chart
Forward primer(s):ITS1 (5' TCCGTAGGTGAACCTGCGG 3') 
Reverse primer(s):IT2 (5' CCTCCGCTTATTGATATGCTTAGG 3') 
Additional information:Conjunctivitis 
Genbank URL:
Depositor:Dirk Stubbe 
Institution:BCCM/IHEM, Biomedical fungi and yeasts collection, Scientific Institute of Public Health, Brussels, Belgium 
Contact details:P: +32 2 6425590; 
Primers Reference:White et al. 1990. PCR Protocols: A Guide to Methods and Applications p. 315-322.; and Beguin et al. 2012. Medical Mycology 50:871-882. 
Strain number:IHEM 22508 
Other numbers:RV 32683 
ID confirmed biochemically or morphologically:yes 
Year of isolation:1974 
Place of isolation:NA 
Specific source:Human eye 
product "18S ribosomal RNA":<1..45 
product "internal transcribed spacer 1":46..187 
product "5,8S ribosomal RNA":188..345 
product "internal transcribed spacer 2":346..509 
product "28S ribosomal RNA":510..>557 
Length:557 bp. 
(28.613900°; 77.209000°; ?) ± ? km (Hide map)
Depositor link: